Filters

List of zinc nitrate Tenders

List of latest zinc nitrate Tenders in Indian Tenders. Click on any zinc nitrate Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for zinc nitrate Tenders.

All-Tenders (9)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :34304389 | 23 Apr, 2025

Tender Value : 0

Visakhapatnam - Andhra Pradesh

Tender for gem bids for aceclofenac 100 plus paracetamol 325 plus chloroxazone 250 tab hifenac mr , aceclofenac 100 plus serratio 15mg plus pcm325mg tab , aceclofenac 100 mg plus thiocolchicoside 4 mg tab , alpha ketoanalogue 200 mg tab , alpha lipoic acid plus chromium plus folic acid methylcobalamin plus selenium plus zinc , amiodarone 100 mg tab , carvedilol 10 mg tab , collagen peptide 40mg plus sod hyluru 30mg plus chondrotin tab , ed brinzolamide 1.0 plus timolol 0.5 percentage 5 ml , glucosamine sulphate 750mg plus methyul sulphonylmethaone 200mg plus oxydents and minerals , lamivudine 150mg plus zidovudine 300mg plus neverapine 200mg tab , letrozole 2.5mg tab , naproxen 500 mg tab , telmisartan 40 mg plus chlorthalidone 12.5 mg tab , thiocolchicoside 4 mg myoril tab , ed brinzolamide 1 percentage , buspirone hcl 10 mg tab , diclofenac 50 mg plus serratiopeptidase 10 mg tab , diclofenac spray bottle of 40 gm , mirabegron 25mg tab cap , neomycin plus polymixin plus bacitracin neosporin powder , nitrofurantoin 100 mg cap , pancreatine minimicrosphere with lipase 25000 cap , hydralazine 37.5 plus isisorbide dinitrate 20 mg tab isolazine , tenofovir 300 plus emtricitabine 200mg efavirenze 600mg tab plus , trypsin and chymotrypsin 6 is to 1 100000 au enteric coated chymoral forte tab , inj diclofenac 25mg ml 3ml voveran , sacubitril 24mg plus valsartan 26mg tab , metronidazole plus chlorhexidine plus lignocain oral gel , glyceryl nitrate 2.6 tab , telmisartan 40 mg plus amlodipine 10 mg tab , human insulin analogue rapid acting inj 100 iu ml recombinant dna origin 3 ml pfs , brimonidine 0.2 percentage plus timolol 0.5 percentage eye drops

Central Government/Public Sector

TRN :34284008 | 19 Apr, 2025

Tender Value : 0

Ferozepur - Punjab

Tender for gem bids for dasatinib 50 mg tab , dengue test kit , diclofenac sodium 100 mg sr tab , diltiazem 60 mg tab , disposable insulin pen needles 4mm , distilled water , divalproex sodium cr 500 mg tab , dutasteride 0.5 mg tab , ed hydroxy propyl methylcellulose dextran glycerin polysorbate 80 with polyquad preservative eyemist , enalapril 2.5 mg tab , entecavir 0.5 mg tab , ed latanoprost plus timolol , ed pilocarpine , eye oint hypromellose 2 hydroxypropyl methylcellulose 2 per ocular lube , fenofibrate 145 mg tab , fenofibrate 200 mg tab , ed flurbiprofen sodium 0.3 percentage 5 ml , inh formoterol 6 mcg plustiotropium 9mcg mdi , frusemide 40 mg tab , gatifloxacin 0.3 percentage eye drop bott of 5 ml e d , ibuprofen syrup 100mg 5ml bott of 50 ml , indapamide sr 1.5 mg tab , insulin highly purified human neutral 40iu ml 10 ml inj regular , insulin highly purified isophane human nph 40iu ml10 ml inj , isabgol ispaghula husk 3.5 gm , isosorbide dinitrate 10 mg tab , kit for estimation of bilirubin 4x60ml , kit for estimation of cholestrol 5x20ml , kit for estimation of glucose 2x200ml , kit for estimation of hdl 2x50ml , kit for estimation of triglyceride 5x20ml , kit for estimation of uric acid 5x20ml , lamivudine 150 mg tab , lancet disposable with std , lotepredenol etabonate 0.5 per bott of 5 ml , malaria ag kit rapid , metformin 1000mg tab , methotrexate 5mg tab , methylcobalamin 500mg tab , micro tips 100 to 1000 ul pkt of 1000 , micro tips 5 to 50 ul pkt of 1000 , mirabegron 25mg tab , mycophenolate sodium 360mg tab , neomycin polymixin bacitracin neosporin powder , naphazolin 0.01 percentage ed , nevirapine 200 mg tab , nifedipine retard 20 mg tab , nitrofurantoin 100 mg cap , betamethasone 0.05 per salicylic acid 3 per oint , ondansetron 8 mg tab , oral teething sol 10ml , paracetamol syp 125mg 5ml , paradichlorobenzene 2 per benzocaine 2.7 per chorbutol 5 percentage turpentine oil 15 per ear drop , prasugrel 5 mg tab , prazosin sr 5 mg tab , pre-pro tab probiotic , printing thermal paper 110mm x 20mtr , pyridostigmine 60 mg tab , quetiapine 50 mg tab , rifaximine 400mg tab , rizatriptan 5 mg tab , ropinirole 0.5 mg tab , sodium valproate 300 mg tab , sterillium 500 ml bottle , sulphamethoxazole 400 mg plus trimethoprim 80mg tab , syp iron with vitamin b 12 and folic acid bottle of 200ml syp , azathioprine 100 mg tab , deflazacort 6 mg tab , hydralazine 37.5 plus isisorbide dinitrate 20 mg tab , lacosamide 100mg tab , mebeverine 135 mg tab , mebeverine 200mg tab , pantoprazole 40mg plus itopride 150mg cap , prednisolone 10mg tab , tamoxifen citrate 20 mg tab , telmisartan 20mg tab , tenofovir 300 emtricitabine 200mg efavirenze 600mg tab , test tube 100x12mm , tetrabenzeme 25mg tab , thiocolchicoside 4 mg myoril tab , thyroxine 50 mcg tab , timolol maleate eye drop 0.5 per bott of 5 ml , tolvaptan 15 mg tab , tramadol 50 mg plus paracetamol tab , tranexamic acid 500 mg plus mefenamic 250 mg tab , trypsin and chymotrypsin 6 1 100000 au enteric coated tab , uristick bott 100 strip , venlafaxine 37.5mg tab , vildagliptin 50mg tab , vitamin b complex therapeutic tab cap , widal test 4x5ml , ziprasidone 40 mg tab , zolpidem 5 mg tab , esr disposable piptte , 5 amino salicylic acid 400 mg , candid mouth paint clotrimazole , thiocolchicoside 8 mg tab , pramipexole 0.5 mg tab , torsemide 100 mg tab , prasugrel 10 mg tab , thyroxine 100 mcg tab , ezetimibe 10 mg tab , inj diclofenac 25mg ml 3ml , tadalafil 20mg tab , betahistine 16 mg tab , sitagliptin 50 mg tab plus metformin 1000 mg tab , colostomy paste , lamotrigine 100mg tab , levetiracetam 1000 mg tab , piracetam 800 mg tab , gliclazide 40 mg tab , prucalopride 1 mg tab , aceclofenac 100 mg tab , clobetasol plus neomycin cream , inj hepatitis b 10ml , zolpidem 10 mg tab , chlorthalidone 6.25 mg tab , leuprolide acetate 22.5 mg inj , clobetasol miconozole gentamycin oint , cefixime 200mg clavulanate 125 mg tab , fluticasone propionate 50 mcg bp nasal spray , ed moxifloxacin plus dexamethasone , eplerenone 50 mg tab , ed brinzolamide plus brimonidine , duloxetine 30 mg tab , faropenem 300mg extd relese tab , rifaximine 550 mg tab , gamma benzene hexachloride 1percentage cetrimide 0.1per lotion 100ml gbhc , tretinoin 0.05 percentage oint 60 gm , betamethasone plus gentamycin oint , fluvoxamine 50mg tab , methotrexate 7.5 mg tab , diltiazem cd 120 cap tab , desloratadine 5mg tab , inj darbepoetin 60 mg , mirabegron 50 mg tab , hbs ag kit , entacapone 200mg levodopa 150 mg carbidopa 37.5 tab syncapone 150 , digital x ray film 10 x 8 carestream , digital x ray film 12 x 10 carestream , serratiopeptidase 10mg tab , diclofenac 50mg pcm 500mg tab , isotretinoin 10 mg tab , chlorzoxazone 500mg diclofenac 50mg paracetamol 325mg tab , inj biovic 90mg sodium hyaluronate , syp azithromycin 200 mg 5ml , hydrochlorothiazide 25 mg tab , inj ondansetron 2 mg ml , pantoprazole 20 mg tab , chlordiazepoxide 10 mg tab , acebrophylline 200 mg sr , pirfenidone 200 mg tab , inj dicyclomine 20 mg , deferasirox 500 mg tab , midodrine 2.5 mg tab , eye oint ciprofloxacin , glycopyrronium 25 mcg smartules , alpha lipoic acid chromium folic acid methylcobalamin selenium zinc , inj normal saline 100 ml , sodium valproate 500 mg tab , isosorbid mononitrate 20 mg tab , cefoperazone so1gm , inj paracetamol 150mg ml 2ml iv , cetrizine 5mg paracetamol 325mg phenylephrine hcl 5mg , glucosamine 500 mg diacerin 50 mg tab , rivaroxaban 2.5 mg tab , spironolactone 50 mg tab , diclofenac plus paracetamol plus serratiopeptidase tab , naproxen 500 mg tab , efavirenz 600 mg tab , pantaprozole 40 mg plus domperidone 10 mg tab , inj lignocaine 2 percentage with adrenaline , glyceryl nitrate 2.6 tab , savlon liquid bott of 1 ltr , amitryptalline 25 mg tab , bromhexine 100 ml syp , nortriptyline 10 mg tab , crp kit span , sgpt kit erba , ofloxacin orninizole itraconazole clobetasol orniderm cream , syp cefixime 50 mg , perampanel 4 mg tab , biphasic isophane insulin 30 as soluble insuline70 isophan insulin suspension 100iu 3 ml mixtard 30 cart , kit for estimation of alkaline phosphate 10x2.2ml , memantine 10 mg tab , glucosamine 750 mg diacerine 50 mg msm 200 mg tab , capillary tube , aceclofenac 100 paracetamol 325 chloroxazone 250 tab , ear drop chloramphenicol 5per clotrimazole 1 betamethasone 0.25lignocaine hcl 2per in bottle of 5 ml , sumatriptan 85 mg naproxen 500 mg tab , hcv test kit pkt of 25 test , tolperisone sr 150 mg tab , normal saline 1000 ml , inj zoledronic acid 4 mg , inj methylcobalamin 1500 mcg , dexamethasone 4mg tab , ed netarsudil 0.02 percentage , brivaracetam 75 mg tab , nicorandil 5 mg tab , olmesartan 40 mg tabdium 1gm and sulbactum sodium

Central Government/Public Sector

TRN :34278450 | 16 Apr, 2025

Tender Value : 0

Kangra - Himachal Pradesh

Tender for gem bids for potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g

Central Government / Public Sector

TRN :34280281 | 17 Apr, 2025

Tender Value : 0

Sagar - Madhya Pradesh

Tender for gem bids for acarbose 50 mg tab , acebrophyllin 100mg and acetycstine 600mg tab , acebrophylline 100 mg tab , aceclofenac 100 paracetamol 325 chloroxazone 250 tab , aceclofenac 100 serratio 15mg pcm325mg tab , aceclofenac 100 mg paracetamol 325 mg thiocolchicoside 4 mg , aceclofenac 100 mg paracetamol 325 mg tab , acenocoumarol 1 mg tab , acenocoumarol 2mg tab , acyclovir 3 percent wbyw eye ointment , acyclovir 400 mg tab , acyclovir 5 percent oint , adapalene 0 point1 percent gel , isoniazid 225mg rifampicin150mg ethambutol400mg pyrazinamide 750mg , alcoholic hand sanitizer bott of 500 ml , alendronate sodium 70 mg tab , alfuzosin 10 mg tab , alovera and vitamin e lotion , alpha lipoic acid chromium folic acid methylcobalamin selenium zinc , alprazolam 0 point 25 mg tab , amantadine 100 mg tab , amitriptyline 10 mg tab , amitryptalline 25 mg tab , amlodepine 10 mg tab , amlodipine 5 mg tab , antacid chewable containing dried aluminium hydroxide ip 250mg mag hydroxide nf 250mg methyl polysiloxane 50 mgtab , aripiprazole 5 mg tab , aspirin 75 mg atorvastatin 10 mg tab , azelastine 140 mcg fluticasone 50 mcg nasal spray , baclofen 10 mg tab , bandage 10 cm x 4 meters , bandage 2.5 cm x 4 metres , beclomethasone dipropionate 50 mcg per dose metered dose aerosol 200 dose unit , beclomethasone dipropionate 50 mcg levosalbutamol 50 mcg mdi , betadine oint , betahistine 16 mg tab , betahistine 8 mg tab , betamethasone gentamycin oint , biotin 10mg iron 8mg l cysteine 5mg manganese 5mg copper selenium l lysine 20mg zinc 25mg dimethionine 40mg calcium pantothenate 50mg niacinamide50mg tab , bisacodyl 5 mg tab , bisoprolol 2 point 5mg tab , bisoprolol 5mg tab , brimonidine 0 point2 percent w byv eye drops , brivaracetam 100mg tab , bromhexine 100 ml syp , bupropion 150 mg tab , cabergoline 0percent5 mg tab , calamine lotion 100 ml , calcium and vit d3 syp 200ml bott , calcium carbonate and calcitirol and methulcobalamin and vitamin k2 and zinc tab , calcium citrate malate and vitamin d3 tab , canagliflozin 100 mg tab , mouth paint clotrimazole , carbamazepine 200 mg cr tab , carbidopa 10 mg and levodopa 100 mg cr tab , carbidopa 18 percent 75 and levodopa 75 mg and entacapone 200 mg tab , carbidopa 25 and levodopa 250 mg tab syndopa 275 mg , carbidopa 25 mg and levodopa 100 mg cr tab , carbimazole 5mg tab , carvedilol 12 percent5 mg tab , carvedilol 6 percent25 mg tab , cefixime 200 mg tab , cefixime 200mg and clavulanate 125 mg tab , cervical collar size l , cervical collar size m , cervical collar xl , cetrizine 5mg and paracetamol 325mg andphenylephrine hcl 5mg , chest binder all size , chlordiazepoxide 10 mg tab , chlordiazepoxide 5 mgand clidinium bromide 2 percent5 mg , chlorhexidine mouth wash 2 percent bott of 100 ml , chlorhexidine mouthwash 2 percent bottle of 150 ml , chlorthalidone 12 percent 5 mg tab , chlorthalidone 6 percent25 mg tab , choline salicylate 8 percent andlidocaine 2dologel , cilnidipine 10 mg tab , cilnidipine 5 mg tab , cilostazol 100 mg tab , cinitapride 3mg pantoprazole 40mg tab , cinnarizine 25mg tab , ciprofloxacin 500mg tab , clarithromycin 1 percent gel 15gm , clavicle support medium size , clindamycin 1 percentgel 10 gm , clindamycin 300 mg cap , clobazam 10mg tab , clobazam 5 mg tab , clobetasol miconozole gentamycin oint , clofazimine 100 mg cap , clonazepam 0 percent5 mg tab , clotrimazole 1 percent w by v ip and and lignocaine 2 percent w byv ip ear drop bott of 10ml , clotrimazole 100mg vaginal tablets , clotrimazole cream 1 percent tube of 15 gm , coenzyme q10 100 mg tab , colchicine 0 percent 5 mg tab , collagen peptide and hyaluronate tab , collagen peptide 40mg and sod hyluru 30mgand chondrotin tab , coloplast lubricating deodrant , coloplast paste 2650 , coloplast plate , colostomy bag 60 mm , colostomy bag with flange and clamp size 50and 57 mm with deodorant charcoal chamber , colostomy bag with flange and clamp size 60 and 67 mm with deodorant charcoal chamber , colostomy bag with flenge 50mm , colostomy bag with flenge 60mm , colostomy belt , corn cap , cotton 50 gm pkt , cotton absorbent 500 gm , cotton non absorbent 500 gm , cyclosporin 50 mg tab , cyproheptadine 4 mg tab , cyproterone 2mg ethinyl estradiol 0point0 35mg ginnete 35tab , dabigatran 110 mg tab , dapagliflozin 5 and linagliptin 10 mg tab , denosumab 120 mg by ml inj , dental gel , desensitising paste stannous fluoride potassium nitrate sod monofluorophosphate tube of 50gm , desvenlafaxine 100 mg tab , diclofenac 50 mg and paracetamol 325 mg tab , dicyclomine 10mg and mefenamic acid 250mg tab , digoxin 0 point 25 mg tab , diltiazem 60 mg tab , divalproex sodium cr 500 mg tab , domperidone 10 mg tab , donepezil 10 mg tab , donepezil 5 mg tab , dorzolamide 2 per w by v and timolol 0 point 5 percentw by v eye drop , dosulepin 25 mg dothiepin tab , dosulepindothiepin prothiadren 50 mg tab , doxepin 75 mg cap , duloxetine 20mg cap , duloxetine 30 mg tab , dutasteride 0.5 mg tab , dvt stocking medium , dvt stocking small , dvt stocking xl , dydrogesterone 10 mg duphaston tab , ear drop chloramphenicol 5percent w by v clotrimazole 1percent wby v betamethasone 0 point 25percent w by v lignocaine hcl 2percent w by v in bottle of 5 ml , ecg electrodes , ecg gel , ecg roll , eye drop 0point 2 per olopatadine hydrochloride with povidone iodine and drop tainer systme , ed carboxy methyl cellulose 0 point5 percent bott of 5ml , ed ciprofloxacin and dexamethasone , ed ciprofloxacin 0point 3 percent , ed cyclosporine 0point 05 percent bott of 5ml , ed dorzolamide 2 percentwby v , ed moxiflox , ed moxifloxacin and dexamethasone , ed nepafenac 0 point 1percent wby v , ed olopatadineand ketorolac , ed prednisolone 1percent , tamsulin 0 point 4 mg and dutasteride 5 mg tab tab , silodosin 8 mg and dutasteroide 0point 5 mg tab , empagliflozin 5mg and metformin 500mg tab , enalapril 2point 5 mg t ab , enalapril 5 mg tab , entacapone 200mg and levodopa 150 mg and carbidopa 37point 5 tab , entecavir 0 point 5 mg tab , enzalutamide 40mg tab , eplerenone 25 mg tab , escitalopram 10mg tab , escitalopram 5 mg and clonazepam 0point 5 mg tab , escitalopram 5 mg tab , ethamsylate 500 mg tab , ethinyl estradiol 0point 03mgand drospirenone 3 mg kit of 21 tab , etizolam 0point 5mg tab , etophylin 77mg andtheophylin 23mg , etoricoxib 60 mg tab , faropenem 300mg extd relese tab , febuxostat 40mg tab , fenofibrate 145 mg tab , fenofibrate 160mg tab , ferrous fumarate and folic acid , fexofenadine 120 mg point montelukast 10mg tab , fexofenadine 120mg tab , finasteride 5 mg and tamsulosion 0point 4 mg cap , flunarizine 10 mg tab , fluoxetine 20mg tab , flupentixol 0point 5 mg and melitracen 10 mg tab , fluticasone oint , fluticasone propionate 50 mcg bp, nasal spray , fourderm cream chlorhexidine gluconate 0 point 2 percent clobetasol topical 0point 05percent miconazole topical 2 percent, neomycin topical 0 point 5 percent 30 gm , framycetin sulphate cream bp 1percent cream 15 or 20 gms , frusemide 20 mg andspironolactone 50 mg tab , frusemide 40 mg tab , fusidic 2percent and clotrimazole 1 percent clobetasol 0point 05percent oint , gabapentin 100mg tab , gabapentin 300mg and methylcobalamin 1500 mcg tab , gabapentin 300mg tab or cap , gamma benzene hexachloride 1point and cetrimide 0point1 point lotion 100ml gbhc , gatifloxacin 0 point 3percent eye drop bott of 5 ml , gentamycin eyeand ear drop , gliclazide 30 mg mr tab , gliclazide 40 mg tab , gliclazide 60 mg and metformin 500mg tab , gliclazide 60 mg mr tab , gliclazide 80 mg tab

State Government

TRN :34247733 | 12 Apr, 2025

Tender Value : 0

Kangra - Himachal Pradesh

Tender for gem bids for oxalic acid graterthan 99point5 percent cas 6153-56-6 , 2 4 dinitrophenol 99 percent cas 51-28-5 3x100gm , abts 2 2-azino-bis 3-ethylbenzothiazoline-6-sulfonic acid diammonium salt 30931-67-0 , acetylcholine chloride ar 1 pack of 10 g , ag agcl 3m kcl reference electrode basmf2056-1ea , ag 50w to x8 cat exch resin biotechnology grade 100 to200 mesh hydrogen form , al2o3 pl slurry 0.05meu 1pkt of 10g , al2o3 pl slurry 0.3meu 1pkt of 10g , al2o3 pl slurry 0.5meu 1pkt of 10g , aluminium foil 25micrometer 20 roll per piece 50m , ammonium fluoride ar acs assay 98 percent cas 12125- 01-8 1pack of 25 g , arsenic iii oxide ar assay 99 percent cas 1327-53-3 1pack of 500g , benzofuran for synthesis cas no 271896 b8002-25g , bis salicylaldehyde orthophenylene diamine reagent , bolds basal medium , boron trichloride 178934-100g , bromcresol green cas 76- 60-8 , bromcresol purple ar cas 115-40-2 , bromphenol blue ar cas 115-39-9 , cadmium nitrate tetrahydrate purified assay 99 percent cas 10022-68-1 1pack of 100 , cellulose acetate cas 9004-34-6 , cellulose powder, for column chromatography , centrifuge tube box polypropylene 15ml tarson polylab axiva , centrifuge tubes 50 ml 5 packets 200pc per pack , cetrimide agar , chitosan cas 9012-76-4 , cholchicine 64-86-8 , copper sulphate anhydrous cas no 12852-250g , cresol red ar, cas 1733- 12-6 , cuprous iodide 99 percent cas 7681-65-4 , curcumin grater than equal to 94 percent purity cas no 458-37-7 00280590-10 mg x2 00280590-10mg , curcuminoids 80 percent purity cas no 458-37-7 c7727-500mg , desicator vaccum polypropylene diameter 200mm tarson or polylab , dichloromethane 34856-1ltr , dimethylamine cas 124-40-3 dmf cas no 68122 , dmso cas no 67-68-5 , dpph cas no 1898664 d9132-5gm , dulbecco phosphate buffered saline d5652-10x1l , eppenndorf-microcentrifuge tubes 1.5ltr , ethanol 99 percent , ethylenediaminetetraacetic acid disodium salt dihydrate , centrifuge tubes 15ml , folin and ciocalteu phenol reagent , formaldehyde cas no 50-00-0 252549-100ml , formic acid gr 98.0-100 percent cas no 64- 18-6 , furan for synthesis assay 99 percent cas 110-00-9 1 pack of 100ml , furfuraldehyde ar acs assay 99percent cas 98-01-1 1 pack of 500 , gallic acid 149-91-7 , glycerol 56-81-5 , graphite fine powder 98percent cas 16940-66-2 , high salt medium , hydrogen peroxide solution 30percent cas 7722-84-1 , icp multi-element standard solution iv sigma merck 23 elements in diluted nitric acid 1000 mg l ag, al, b, ba, bi, ca, cd, co, cr, cu, fe, ga, in, k, li, mg, mn, na, ni, pb, sr, tl, zn , immersion oil , in line syringe filter holder 25mm psf tarson or polylab or axiva , in line syringe filter holder 47mm psf tarson or polylab or axiva , iron oxide cas no 1309-37-1 , l-malic acid 99percent cas 97- 67-6 , lb broth , macconkey agar , mask , methyl diethanol amine cas 105-59-9 , methyl orange cas 547-58-0 3x100gm , methyl red cas 493-52-7 3x100gm , methyl yellow cas 60-11-7 3x100gm , mini spatula , n-methyl-2- pyrrolidone for hplc 99percent , naoh-solid cas no 1310732 6x1kg , neutral red ar cas 553-24-2 , nutrient agar , nutrient broth , p-nitrophenol ar cas 100-02-7 , parafromaldehyde cas 30525-89-4 , petroleum ether cas no 8032324 , phenol red sodium salt indicator cas 34487- 61-1 , phenolphthalein indicator cas 77-09-8 5 x100gm , phenyl boronic acid cas 98-80-6 1pack of 25g , pipette rack horizontal z shape polypropylene tarson or polylab oraxiva , pnpa-paranitrophenylacetate 2 bottle of 25g , polyvinylidene fluoride cas 24937-79-9 , polypropylene beaker garduated 500mltarson or polylab or axiva , polypropylene forcep , polypropylene measuring cylinder graduated class a 500ml tarson or polylab , potassium hydroxide 90 percent flakes 484016-1kg , potassium permanganate 238511-100gm , potassium persulphate 7727-21-1 , potassium sulphate cas no 7778805 223492- 500gm , potato dextrose agar , potato dextrose broth , ptfe stirrer 10 x 250mm , pyrrole for synthesis assay 97.5percent cas 109-97-7 1 pack of 100ml , quinoline for synthesis 1 pack of 500ml , rosolic acid cas 603-45-2 , sabaourd dextrose agar , safety face shield tarson or polylab or axiva , scintillation vial polypropylene 20ml tarson or polylab or axiva , silicon oil for oil baths upto 250 degree celsius 1pack of 2.5l , silicon oil for oil baths upto 250 oc cas 63148-62-9 , sodium azide less than 99.5 percent cas 26628-22-8 , sodium borohydride 98.5percent cas 16940-66-2 , sodium chlorate 1pack of 100g , river sedimentbioavailable phosphorous standard bcr684-35g , sodium sulphate anhydrous cas no 7757826 238597- 500gm , stainless steel scoop 500gm capacity , stearic acid cas no 57-11-4 , succinic acid 99percent cas 110-15-6 , sulphur cas no 7704349 13825-1kg-r , sulphuric acid 98percent , tlc plates aluminium oxide coated with fluorescent indicator f254 1 pack of 20 units , tray , tris acetate phosphate cas no 77861 252859-500gm , universal ph indicator , utility tray polypylene 320x 260x70 tarson or polylab or axiva , utility tray polypylene 540x 435x 130 tarson or polylab or axiva , yeast extract peptone dextrose 79883-500g y1500 , zinc oxide cas no 1314-13-2 , zinc sulphate 7446-19-7 , hydrochloric acid 12 n cas number7647-01-0

Central Government/Public Sector

TRN :34227953 | 07 Apr, 2025

Tender Value : 0

Kolkata - West Bengal

Tender for supply of benzoyl peroxide 2 point 5 percentage tube of 20 gm , fluconazole 150 mg cap oblique tab , octinoxate, avobenzone oxybenzone and zinc oxide lotion spf 15 or more 50 ml bottle , tacrolimus oint 0 point 03 percentage 20 gm tube , adapalene 0 point1percentage tube of 15 gm , clofazimine 100 mg cap , ivermectin tab 6mg , prednisolone 5 mg tab , clobetasol propionate cream 0 point 05 percentage in tube of 10 gm , framycetin sulphate cream bp 1 percentage cream 20 gms , salicyclic acid 3 to 5 percentage and coal tar 1 to3 percenatge soln bott , triamcinolone acetate 10 mg oblique ml inj , clarithromycin 1 percentage gel 15 gm tube , coal tar 6 percentage v oblique w plus salicylic acid 3percentage ointment 50 gm tube , extractum capae, heparin sodium , allantoin gel 20 gm tube , halobetasol propionate lotion 0 point 05 percentage w oblique v bottle of 30 ml , fusidic acid cream 2 percentage w oblique w 10g tube , cyclosporine a micro emulsion 100 mg oblique ml bottle of 50 ml , desonide 0 point 05percentage bott of 30 ml , terbinafine 1percentage cream tube of 10 gm , tretinoin 0 point 05 percentage tube of 20 gm , hydroxyzine hcl 25mgtab , tab valaciclovir hcl 500 mg , 13 point 9 percentage eflornithine cream 15g tube , fluocinolone acetonide 0 point 01percentage coma hydroquinone 2percentage plus tretinoin 0 point 025percentage tube of 20gm , acitretin 25mg cap , ointment salicylic acid 12percentage coma tube of 50gm , acetyl tetrapeptide 3 coma butylene glycol coma dextran coma inositol sera solution bottle of 60 ml , cream amorolfine 10gm , clobetasol propionate 0 point 05percentage and fusidic acid 20 gm , eberconazole nitrate 0 point1 percentage tube of 30 gms , fluocinolone

Central Government/Public Sector

TRN :34232108 | 08 Apr, 2025

Tender Value : 0

Gandhi Nagar - Gujarat

Tender for supply of medicine - tab paracetamol 650 mg, paracetamol with cysteine hcl monohydrate infusion 1000 mg 100 ml, itraconazole 200 mg capsule, tab rosuvastatin 20 mg, tacrolimus 003 tub of 20 gm ung, ung povidine iodine tube of 10 gm, syp cremaffin liquid paraffin and milk of magnesia oral solution, steristrip, midazolam nasal spray 05 mg spray 5 ml bottle, haloperidol 5mg ml inj, salmeterol 25mcg fluticasone 250mcg seroflow, cap rejointglucosamine 250mg chondroitin sulphate 200mg cap, seratiopeptidase 5mg tab, diphtheria and tetanus vaccine dtap vial of 5 ml, zoster cream acyclovir cream, keto diastix bott of 50 strips, kits for estimation of cholestrol erba bott of 5 20 ml, kits for estimation of glucose erba bott of 5 60 ml, kits for estimation of urea erba bott of 5 20 ml, kits for estimation of uric acid erba, kits for estimation of creatinine erba bott of 4 60 ml, kits for estimation of sgot ast erba bott of 5 20 ml, kits for estimation of sgpt alt erba bott of 5 20 ml, triglyceride kit erba bott of 5 20 ml, vitamin d3 200 iu ml drops , corn cap, oflox d ofloxacin 03 , drabkins solution diluting solution for haemoglobin estimation by, ecg paper for bpl cardiart 6208 view, band aid water proof, candid b lotion clotrimazole beclomethasone, wbc fluid, scrub typhus test kit card, wash kit erba bott of 4 50 ml, deionised water distilled water, tminic syp phenylephrine and chlorpheniramine, mucaine gel oxetacaine bp 10mg, karvol plus menthol chlorothymol eucalyptol terpinol camphor, clobetasole propionate neomycin sulphate , ambrohist plus ambroxol hydrochloride , dicyclomine hcl ip 20 mg paracetamol ip 500 mg tab, evion cream vitamin e, sore gel chorine salicylate lignocaine mouth gel, leflunamide 10 mg tab, candibiotic ear drop beclomethasone dipropionate neomycin and clotrimazole, eberconazole 1 cream tube of 30 gm, battery for glucometer c 3v, cilnidipine 10 mg tab, colimex drops , cap vit e 400mg, suction catheter, tab carbamazepine 300 cr, syp tusq dx bott of 100 ml phenylephrine, dolocold paracetamol phenylphrine, aceclofenac 100mg paracetamol 325mg tab, pencil cell, miconazole nitrate cream, vitasip multivitamin drops, feeding tube infant, prolene suture 2 0 pkt of 12 with cutting needle , prolene suture 3 0 pkt of 12 with cutting needle , prolene suture 5 0 pkt of 12 cutting needle , tab tamsulosin 04 mg tab dutasteride 05 mg, migran vasograin tab ergotamine 1mg , terbicad oint terbinafine ofloxacin ornidazole clobetasole, formalin tab, clindasil clindamycin 1 nicotinamide 4 gel, ambrodil s ambroxol hcl salbutamaol guaiphenesin, gabapentin 100 mg cap, tobramycin 03 ed bott of 5 ml, multi para uristicks 10 parameters, spironolactone 50 mg tab, powergyl ofloxacin ornidazole suspension, widal kit rapid card for typhoid, niosalic 6 oint clobetasol and salicylic acid oint, tmf mefenamic acid 250 mg and tranexamic acid 500 mg, levosalbutamol metered dose inhaler 100mcg dose, clocip b ung clotrimazole ip 1 and , syp zinc 20 mg 5 ml bottle of 100 ml , ecg gel, tab zincovit multivitamin multimineral with grape seed extract tab, rabeprazole 20 mg domperidone 30 mg sustained release tab, knee cap, neurobion forte tab vitamin b complex with b12, syrup calcium phosphate 80 mg 5 ml 200 ml bottle, volini spray diclofenac diethylamine methyl , tab pantoprazole 40 mg domperidone 10 mg, syp combiflam ibuprofen and paracetamol suspension, cidex solution, autoclave strips indicator, diluent for three part haematology analyser, lyse for three part haematology analyser, m53p probe cleanser for three part haematology analyser, disposable syringe

Central Government/Public Sector

TRN :34232268 | 08 Apr, 2025

Tender Value : 0

Bhopal - Madhya Pradesh

Tender for supply of inj suggammadex , cap micronized progesterone 200 mg soft gelatine , clindamycin clotrimazole vaginal passary , corn caps , cream aloe vera , drop paracetamol , ear drop chloramphenicol , eye drop brimonidine tartarate with timolol maleate , eye drop chromoglycate , eye drop flurometholone , eye drop loteprednol etabonate ophthalmic suspension , eye drop nepafennac micronized suspension , eye drop proparacaine hydrochloride , gel mouth ulcer , inj dexmedetomidine , inj mephentermine , inj rabieshield immunoglobulin , inj sodium hyaluronate ovd in pfs , inj sodium hyaluronate ovd in prefilled syringes , neosporin powder 10 ml bott , oint neosporin , syp probiotic bott of 60 ml , tab amlodipine 2.5 mg , tab clonazapam 0.25 mg , tab mefenamic acid tranexamic acid , tab pantoprazole domperidone , tab pregabalin mecobalamin , tab rabeprazole domperidone , tab trimetazidine mr , tab rabeprazole 20 mg , eye ointment neomycin , eye ointment neomycin polymyxin b sulfates , inj insulin lispro 100 ml , tab gliclazide sr 80 gm , lotion microgen , etomidate injection , lotion cydezyme for instrument clearing , oxcarbamazepine 600 mg , probiotic liquid , vit d-3 drops , oral caffeine citrate , inj caffeine citrate , chlorpheniramine and phenylephrine drops , paracetamol chlorpheniramine and phenylephrine drops , paracetamol drops , drops containinf dil oil, fennel oil and simethicone , tab thiamine 100 mg , clinidipine 10 mg tab , tab nitazoxanide 500 mg , povidone iodine mouthwash , tab serrotiopetide diclofenac , intravitreal injection ranibizumab 0.5 mg single use vial , tab migraine , tab pryridoxine 40 mg , tab sodium valporate 500 mg , oint sertraconazole 15 gm , tab calcium 150 mg , tab , ursodeoxycholic acid 300 mg , oint nefidipine , tab etizolam 0.5 mg , tab evening primrose 500 mg , eye drops fluoromethalone 5 ml , eye drops polyethylene glycol propylene glycol , inj folinic acid 50 mg , tab nifidipine 20 mg , tab paracetamol tramadol , zolpidem 5 mg tab , tab aceclofenac paracetamol serrotiopeptidase , tab betahistine 16mg , serratiopeptidase 5mg tab , tab nifedipine 10 mg , eye drop brimonidine tartarate with timolol maleate benzalkonium chloride , eye drop brinzolamide with brimonidene , eye drop carboxy methyl cellulose , eye drop loteprednol etabonate , intracameral moxifloxacin pfs ophthalmic sol usp , intracameral phenylephrine tropicamide , eye drop moxifloxacin with droptrainer system , eye drop moxifloxacin dexamethasone with droptainer system , eye drops povidone , eye ointment neomycin, polymyxin b sulfates and bacitracin zinc with hydrocortisone ophthalmic oint , eye drops flurbiprofen sodium hydroxypropyl methyl cellulose polymercuric nitrate , eye oint ciprofloxacin , ophthalmic balance salt solution bss , eye drop polyvinylalcohol povidone chlorbutanol , eye oint neosporin h , eye drop moxifloxacin dexamethasone , eye drop tropicamide , eye drop tobramycin with fluorometholone , eye drop sodium hypochloride , eye drops travoprost with droptainer system , inj rocuronium , sachet l argine , tab estradiol valerate 2mg , tab ethinylestradiol cyproteroneacetate pack of 21 , tab briveracetam 150mg , tab nitrofurantoin sr 100 mg , estriol cream , fas kit , kiwi cup , diclofenac paracetamol , inj sodium hyaluronate with chondroitin sulphate ovd in prefilled syringes , tab tocoretinol xeaxanthin1 mh , sequedrea mdi , povidine iodine surgical scrub , oro sterization indicatore tape , lotion cutasept , hydroxypropylmethylcellulose hpmc , eye gel hydroxy propyl methy cellulose 5 gm , kit for csf micro protein , liquid ammonia solution , haematoxyline and eosine stain , transasia erba h360 calibrator 3 ml , transasia erba h360 control 3x3 ml , transasia erba h360 elit h clean , transasia erba h360 lyse 1x500 , transasia erba h360 dil 1x20 ltr , combi disc gn1 , combi disc gn2 , combi disc gp1 , combi disc gp2 , erba wash kit , pas stain , heamatology 5 part h560 diluent 1 1x20 ltr , erba norm kit , erba path kit , xl multical , erba autowash ac al , heamatology 5 part h560 lyse 1 , heamatology 5 part h560 lyse 2 , heamatology 5 part h560 control 9 ml , erba auto wash , surgical spirit , uristix multi stix , microscope lens cleaning solution , pencil marking glass , formic acid , picric acid , nitric acid , ada kit adenosine deaminase , lipase test , cpap circuit adult , dextrose bott , gelofusion 500ml , soframycin oint 100 gms , tab bromocryptine 5 mg , inj ramifentanil 1 mg , tab prednisolone 10mg , dpi indacaterol glycopyronium , tab heptral , 30 g needle half inch , suture 10-0 nylon , suture 3-0 silk , schirmer strips , disposable cataract surgery box with instument holder matte , tisseel fibrin sealant , sterile earbuds , disposable sterile eye pad dress with sticker , disposable sterlie cannula , esbatch reagents , semen diluting fluid , durhams tube , antioxidant luteine zeaxanthine omega 3 fatty acid , b hex pupil expander , b hex 23g forceps , phaco tip 30dregree tapered compatable with alcon infinity phaco machine , tuberculin syringe , fluoresceine sodium 1mg dry paper strips , albumin , total protein , inj goserelin 3.6 mg , fertilizing media , disinfection wipes for cleaning bench top , kim wipes disposable wipes , sperm preparation media for iui single density

Central Government/Public Sector

TRN :34213185 | 09 Apr, 2025

Tender Value : 0

Koraput - Orissa

Tender for supply of 120 zinc nitrate

Related Searched Keywords : zinc nitrate

List of zinc nitrate Tenders

Tender for supply of 120 zinc nitrate

Get zinc nitrate Tender Alert...

Related Searched Keywords : zinc nitrate

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us